Analogy/Homology

HOMOLOGUS TRAITS

a. After doing some research, I found really interesting that humans and dogs had any kind of ancestral connection. Humans are bipedal primates belonging to the genus Homo, especially Homo sapiens. In taxonomy, humans belong to the family hominidae, of the primates, under class mammalia of phylum chordata. Dogs are distinguished for intelligence, docility, and attachment to man, and is mammal too.

b. Humans and dogs have similar pelvises, but they don’t look alike and have different functions. The canine pelvis is long and narrow while the human pelvis is short and broad. In humans, the pelvis provides a location for the large muscles of the lower body to connect, giving humans the ability to walk, run, sit and kneel.  In dogs, the pelvis encircles the pelvic cavity and has several functions including protecting the pelvic viscera, and the reproductive and urinary organs. The pelvis is also essential in locomotion and posture. In addition to similar bones structures, they also have similar upper limb muscles. We can determine whether a muscle is homologous by looking at which bones it attaches to and what function it performs.

c. Well, we don’t know the common ancestor that connect this two, but both are mammals that means they have backbones or spine, and other characteristics in common.

 ANALOGOUS TRAITS

a.   After doing some research I also found really interesting putting sharks and dolphins together and see what makes them so different. Sharks are a long-bodied chiefly marine fish with a cartilaginous skeleton, a prominent dorsal fin, and toothlike scales. Most sharks are predatory, although the largest kinds feed on plankton. Dolphins are highly intelligent marine mammals and are part of the family of toothed whales that includes orcas and pilot whales. They are found worldwide, mostly in shallow seas of the continental shelves, and are carnivores, mostly eating fish and squid.  

b.   In Sharks and Dolphins, the dorsal fin keeps them upright, it prevents the body from tipping or rolling over, providing stability while swimming. They are anatomically different. The dorsal fin of sharks is rigid, and supported by cartilage internally. The dorsal fin of dolphins has no internal support. They are held erect by collagen fibers in the outside skin only.

c.   If we go back in time, maybe we could find an animal similar to both, but dolphins evolved from mammals and sharks evolved from fish, both have different and similar characteristic and have different ancestors. Both developed their similar fins due to a common environmental pressure.

 i liked that image, because we can clearly see the difference in the fins of sharks and dolphins. 

DNA MOLECULE

DNA Molecule:

TGCATACCACGTTAGCCCCTCCAGTTCAAATCACGAGTTGTAAATCACTG

HISTORICAL INFLUENCES ON DARWIN

ALFRED RUSSEL WALLACE

1. Alfred Russel Wallace had the most influence over Darwin’s development of his theory Natural Selection. 
2. Alfred Russel Wallace (1823-1913) was born into a family of modest means. He went to work at the age of 14 and, with little formal education, moved from one job to the next. Eventually he became interested in collecting plants and animals and joined expeditions to the Amazon and Southeast Asia, where he acquired firsthand knowledge of many natural phenomena. He also sailed to the Malay Archipelago (now Singapore, Malaysia and Indonesia) where he spent nearly eight years collecting and studying the local wildlife. He made very significant contributions, not just to biology, but also to subjects as diverse as glaciology, land reform, anthropology, ethnography, epidemiology, and astrobiology. His pioneering work on evolutionary biogeography (the study of how plants and animals are distributed) led to him becoming recognised as that subject’s ‘father’
3. Wallace’s theory was that current species were descended from other species and that the appearance of new ones was influenced by environmental factors. He also described evolution as a process driven by competition and natural selection. Darwin and Wallace agree that in order for natural selection occur, reproduction must occur and that plants and animals have to adapt to environmental changes to survive.
4. Darwin and Wallace were working on the natural selection theory each one on their own. Darwin began formulating his theory in the late 1830s and worked on it for almost twenty years. He wanted to have lots of evidence before making public his idea. Wallace supplied Darwin with birds for his studies and decided to seek Darwin's help in publishing his own ideas on evolution. When he sent Darwin his theory in 1858, Darwin was in shock realizing that Wallace theory was nearly replicated Darwin's own. So I don’t think Darwin needed of Wallace to have his own theory but, I do believe with Wallace’s report, Darwin felt he was right.
5. By that time any ideas of evolution were associated with atheism and political subversion, this kept him from publishing, also the thought that if these ideas were accepted, “the Church would crash, the moral fabric of society would be torn apart, and civilized man would return to savagery” (Desmond and Moore, 1991, p. 34) was enough for him to stay quiet. He also wanted enough data to support his theory.

http://wallacefund.info

https://www.theguardian.com/science/2013/jan/20/alfred-russel-wallace-forgotten-man-evolution

SCIENTIFIC METHOD

1.   Hypoyhesis: The student is a single dad, with a full time job and two little girls that he has to take care of. (he’s always extra tired)

2.   Test:

A.  I would test this hypothesis by hiring a nanny at least 3 times a week, so the student can get some rest. The conditions would be altered in the available time the student will have.

B.  If the student was awake the whole class, my hypothesis would be fine.

C.  If the student falls asleep again, my hypothesis would be falsified. 

3.   Untestable Hypothesis: An example of an untestable, unfalsifiable explanation would be, that maybe the student while in class, he falls asleep, and starts dreaming, thinking he is taking the class.

First assignment

If you were stranded on a desert island what two items you would take with you and why? 

 This question is too funny, because I always joke with my husband, if one day I get lost on a desert, the woods, an island, I don’t know anywhere but I am on my own I would not survive 2 days, Lol. Now, I think that thought is true, and to be honest the first to two things that come to mind are a photo of my daughters and my husband to give me strength to go through hard times, always thinking positive that I am going to see them again, and a tooth brush because I just can’t live with dirty tooth, Lol. Well, as you all can see I have no survival spirit or instinct, I think I would stay in one place waiting for someone to come and rescue me. The struggle is real!! but we are a very cautious family, an example of this is that every time we go out to public places where there are a lot of people, we always assigned a place where if someone gets lost, we should be able to find them.